This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #61252)


Item Catalog # Description Quantity Price (USD)
Plasmid 61252 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Jordan Ward
  • Backbone size w/o insert (bp) 8146
  • Total vector size (bp) 8146
  • Modifications to backbone
    Replaced the sgRNA target sequence in the backbone with a sequence targeting the pha-1 locus near the e2123 allele.
  • Vector type
    Worm Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    sgRNA(F+E) targeting pha-1
  • Species
  • Insert Size (bp)

Resource Information

Depositor Comments

Target sequence: atgaataacttgatgaacat

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJW1285 was a gift from Jordan Ward (Addgene plasmid # 61252)
  • For your References section:

    Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Ward JD. Genetics. 2014 Dec 9. pii: genetics.114.172361. 10.1534/genetics.114.172361 PubMed 25491644