-
PurposeAAVS1 targeting donor plasmid with Flpe-ERT2 expression cassette and Neo selection gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68460 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAVS1-CAG
- Backbone size w/o insert (bp) 8085
- Total vector size (bp) 12748
-
Modifications to backboneamplified mammalian-codon-optimized Flpe recombinase cDNA and ERT2 cDNA by PCR from pDIRE (Addgene plasmid #26745) and pCAG-FlpeERT2 (Addgene plasmid #14756), respectively. The mammalian codon-optimized Flpe fused with ERT2 was inserted into the AAVS1-neo-CAG-hrGFP to replace GFP to get the AAVS1-neo-CAG-FlpeERT2 donor plasmid.
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemammalian-codon-optimized Flpe recombinase fused with ERT2
-
SpeciesSynthetic
-
Insert Size (bp)2243
- Promoter CAG
-
Tag
/ Fusion Protein
- ERT2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer ggcttctggcgtgtgaccggc
- 3′ sequencing primer catagcgtaaaaggagcaaca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Neo-CAG-Flpe-ERT2 was a gift from Su-Chun Zhang (Addgene plasmid # 68460 ; http://n2t.net/addgene:68460 ; RRID:Addgene_68460) -
For your References section:
Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Chen Y, Cao J, Xiong M, Petersen AJ, Dong Y, Tao Y, Huang CT, Du Z, Zhang SC. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. 10.1016/j.stem.2015.06.001 PubMed 26145478