Skip to main content

pMXspuro-GFP
(Plasmid #74203)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74203 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pMXs-puro
  • Backbone size w/o insert (bp) 6900
  • Total vector size (bp) 7600
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Insert Size (bp)
    717

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer GACGGCATCGCAGCTTGGATACAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    GFP was cloned from pMXs-IP-GFP-NBR1, a gift from Noboru Mizushima (Addgene plasmid # 38283)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXspuro-GFP was a gift from Jayanta Debnath (Addgene plasmid # 74203 ; http://n2t.net/addgene:74203 ; RRID:Addgene_74203)
  • For your References section:

    NBR1 enables autophagy-dependent focal adhesion turnover. Kenific CM, Stehbens SJ, Goldsmith J, Leidal AM, Faure N, Ye J, Wittmann T, Debnath J. J Cell Biol. 2016 Feb 29;212(5):577-590. Epub 2016 Feb 22. 10.1083/jcb.201503075 PubMed 26903539