-
PurposeRetroviral control vector containing GFP insert
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74203 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMXs-puro
- Backbone size w/o insert (bp) 6900
- Total vector size (bp) 7600
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
Insert Size (bp)717
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GACGGCATCGCAGCTTGGATACAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGFP was cloned from pMXs-IP-GFP-NBR1, a gift from Noboru Mizushima (Addgene plasmid # 38283)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXspuro-GFP was a gift from Jayanta Debnath (Addgene plasmid # 74203 ; http://n2t.net/addgene:74203 ; RRID:Addgene_74203) -
For your References section:
NBR1 enables autophagy-dependent focal adhesion turnover. Kenific CM, Stehbens SJ, Goldsmith J, Leidal AM, Faure N, Ye J, Wittmann T, Debnath J. J Cell Biol. 2016 Feb 29;212(5):577-590. Epub 2016 Feb 22. 10.1083/jcb.201503075 PubMed 26903539