Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCFD4d-U6-1:white1-U6-3:white1
(Plasmid #84005)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84005 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCFD4d
  • Backbone size w/o insert (bp) 4575
  • Total vector size (bp) 4579
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    white sgRNA-1
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    20
  • Promoter U6:3

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ATTCCTATCCGGCGGTAGTC
  • 3′ sequencing primer TGTACGTCAACGGAAAACCA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    white sgRNA-1
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    20
  • Promoter U6:1

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ATTCCTATCCGGCGGTAGTC
  • 3′ sequencing primer TGTACGTCAACGGAAAACCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFD4d-U6-1:white1-U6-3:white1 was a gift from Phillip Zamore (Addgene plasmid # 84005 ; http://n2t.net/addgene:84005 ; RRID:Addgene_84005)
  • For your References section:

    Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Co-conversion. Ge DT, Tipping C, Brodsky MH, Zamore PD. G3 (Bethesda). 2016 Aug 26. pii: g3.116.032557. doi: 10.1534/g3.116.032557. 10.1534/g3.116.032557 PubMed 27543296