1

Church Lab CRISPR Plasmids Available from Addgene

Addgene is a non-profit plasmid repository. We archive and distribute high quality plasmids from your colleagues. Contact us to learn more.


Bacteria and archaea have evolved adaptive immune defenses termed clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated (Cas) systems that use short RNA to direct degradation of foreign nucleic acids. We have engineered the type II bacterial CRISPR system to function with custom guide RNA (gRNA) in human cells: this involves co- expression of a Cas9 protein bearing a C terminus SV40 nuclear localization signal with one or more guide RNAs (gRNAs) expressed from the human U6 polymerase III promoter. Cas9 unwinds the DNA duplex and cleaves both strands upon recognition of a target sequence by the gRNA, but only if the correct protospacer-adjacent motif (PAM) is present at the 3′ end (see Figure).

Mammalian System: Table 1

We provide a collection of reagents for custom CRISPR mediated gene-targeting. This set of plasmids is described in:

RNA-Guided Human Genome Engineering via Cas9. Mali P, Yang L, Esvelt KM, Aach J, Guell M, Dicarlo JE, Norville JE, Church GM. Science. 2013 Jan 3. PUBMED.

Yeast System: Table 2

To function in yeast cells, we designed Cas9 protein expression constructs using constitutive and inducible promoters as well as a gRNA expression construct using the SNR52 snoRNA promoter.

Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Dicarlo JE, Norville JE, Mali P, Rios X, Aach J, Church GM. Nucleic Acids Res. 2013 Mar 4. PUBMED.

Resources:

  • A Protocol for synthesizing gRNAs or gRNA libraries: Download PDF Protocol

  • A genome-wide resource of ~190k unique gRNAs targeting ~40.5% of human exons can be accessed here.

Orthogonal Cas9 proteins can mediate different activities within a single cell: Table 3

We have characterized a set of orthogonal Cas9 proteins to allow multiple Cas9-mediated activities to be performed simultaneously within individual cells. Because these proteins recognize different guide RNAs, they can be independently targeted to distinct sets of sequences. Our currently available set of Cas9 proteins includes three orthogonal variants optimized for use in human cells and four orthogonal variants usable in bacteria. This set of plasmids is described in:

Orthogonal Cas9 proteins for RNA-guided genome regulation and editing. Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM. Nature Methods. 2013 Sept 29. PUBMED.

Resources:

  • A Protocol for synthesizing gRNAs or gRNA libraries: Download PDF Protocol

  • Cas9 proteins in human cells:

    Streptococcus pyogenes (SP): This is the classical Cas9 protein used in most studies to date.

    Neisseria meningitidis (NM): Significantly smaller than the above Cas9 protein, NM is comparably active as a nuclease and a transcriptional activator.

    Streptococcus thermophilus #1 (ST1): Almost as small as NM, ST1 consistently yields slightly higher activities than the others as a nuclease and as an activator, but is more restricted in the sequences it can target.

    Cas9 proteins in bacteria:

    SP, NM, ST1: all of these efficiently mediate cutting and repression in bacteria, with NM exhibiting slightly superior repression.

    Treponema denticola (TD): Larger than SP, it mediates efficient cutting and nicking in bacteria but performs poorly as a transcriptional repressor.

    All genes except the SP nuclease are human codon optimized but function well in E. coli. Bacteria expressing NM and TD may grow slightly more slowly than those expressing SP and ST1.

    Protospacer-adjacent motifs (PAMs):

    Please note that NM, ST1, and TD recognize different PAMs than does the classical SP Cas9. We experimentally determined these PAMs using a highly stringent selection, which revealed that PAM recognition is more complex than previously thought. In particular, combinations of highly unfavorable bases at positions adjacent to those formally required can significantly reduce activity, while particular protospacers interact nonlinearly with different PAM sequences to determine overall activity at the site. For example, when paired with either of the protospacers utilized in our selection, we observed that NM will recognize sequences with PAMs matching:

    NNNNGA, NNNNGTT, NNNNGNNT,

    just as well as the PAM determined by bioinformatics, NNNNGATT. However, it is possible that NNNNGATT will prove superior for less favorable protospacers and applications requiring particularly tight binding. In these cases it may be advisable to use the consensus sequence. See the publication for details.

    NM PAM:

    ST1 PAM:

    TD PAM:

    NNNNGANN NNAGAA NAAAAN
    NNNNGTTN NNAGGA
    NNNNGNNT NNGGAA
    consensus: consensus: consensus:
    NNNNGATT NNAGAA NAAAAC

    Individual plasmids can be ordered via the links below:

    Table 1
    ID Plasmid
    41824 gRNA Empty Vector: The backbone that a target sequence gets cloned into to create the gRNA. Add to Cart
    41815 hCas9: A human codon-optimized Cas9 expression plasmid. Add to Cart
    41816 hCas9 D10A: A human codon-optimized Cas9 expression plasmid mutated to nick, rather than cut DNA. Add to Cart
    41817 gRNA_AAVS1-T1: A gRNA to human AAVS1. Add to Cart
    41818 gRNA_AAVS1-T2: A gRNA to human AAVS1. Add to Cart
    41819 gRNA_GFP-T1: A gRNA to GFP. Add to Cart
    41820 gRNA_GFP-T2: A gRNA to GFP. Add to Cart
    41821 gRNA_DNMT3a-T1: A gRNA to DNMT3a. Add to Cart
    41822 gRNA_DNMT3a-T2: A gRNA to DNMT3a. Add to Cart
    41823 gRNA_DNMT3b: A gRNA to DNMT3b. Add to Cart
    Table 2
    ID Plasmid
    43802 p414-TEF1p-Cas9-CYC1t: A human codon-optimized Cas9 for expression in S. cerevisiae (budding yeast) from the TEF1 promoter. Add to Cart
    43804 p415-GalL-Cas9-CYC1t: A human codon-optimized Cas9 for expression in S. cerevisiae (budding yeast) from the GalL promoter. Add to Cart
    43803 p426-SNR52p-gRNA.CAN1.Y-SUP4t: A gRNA expression plasmid for use in S. cerevisiae (budding yeast) from the SNR52 promoter. Add to Cart
    Table 3
    ID Plasmid
    48645 DS-SPcas: Bacterial S. pyogenes Cas9 (SP) + tracrRNA expression, cloDF13/spectinomycin. Add to Cart
    48646 DS-NMcas: Bacterial N. meningitidis Cas9 (NM) + tracrRNA expression, cloDF13/spectinomycin. Add to Cart
    48647 DS-ST1cas: Bacterial S. thermophilus #1 Cas9 (ST1) + tracrRNA expression, cloDF13/spectinomycin. Add to Cart
    48648 DS-TDcas: Bacterial T. denticola Cas9 (TD) + tracrRNA expression, cloDF13/spectinomycin. Add to Cart
    48649 PM-SP!TA: Bacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol. Add to Cart
    48650 PM-SP!TB: Bacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol. Add to Cart
    48651 PM-NM!TA: Bacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol. Add to Cart
    48652 PM-NM!TB: Bacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol. Add to Cart
    48653 PM-ST1!TA: Bacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol. Add to Cart
    48654 PM-ST1!TB: Bacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol. Add to Cart
    48655 PM-TD!TA: Bacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol. Add to Cart
    48656 PM-TD!TB: Bacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol. Add to Cart
    48657 DS-SPcasN-: Bacterial nuclease-null SP Cas9 expression. Add to Cart
    48658 DS-NMcasN-: Bacterial nuclease-null NM Cas9 expression. COMING SOON!
    48659 DS-ST1casN-: Bacterial nuclease-null ST1 Cas9 expression. Add to Cart
    48660 DS-TDcasN-: Bacterial nuclease-null TD Cas9 expression. COMING SOON!
    48661 SK-YFP-SPNM-B: Bacterial SP and NM repression YFP reporter: protospacer B. Add to Cart
    48662 SK-YFP-ST1-B: Bacterial ST1 repression YFP reporter: protospacer B. Add to Cart
    48663 SK-YFP-TD-B: Bacterial TD repression YFP reporter: protospacer B. Add to Cart
    48664 SK-YFP-NM-A: Bacterial NM repression YFP reporter: protospacer A. Add to Cart
    48665 SK-YFP-ST1-A: Bacterial ST1 repression YFP reporter: protospacer A. Add to Cart
    48666 SK-YFP-TD-A: Bacterial TD repression YFP reporter: protospacer A. Add to Cart
    48667 EE-SP!gIII: Bacterial SP Cas9 targeting filamentous phage gene III at five protospacers. Add to Cart
    48668 M-SPcas: Mammalian S. pyogenes Cas9 expression, human optimized. Add to Cart
    48669 M-ST1cas: Mammalian S. thermophilus #1 Cas9 expression, human optimized. Add to Cart
    48670 M-NMcas: Mammalian N. meningitidis Cas9 expression, human optimized. Add to Cart
    48671 M-SP-sgRNA: Mammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTG. Add to Cart
    48672 M-ST1-sgRNA: Mammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTG. Add to Cart
    48673 M-NM-sgRNA: Mammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTG. Add to Cart
    48674 M-SPn-VP64: Mammalian SP-VP64 nuclease-null Cas9 activator expression, human optimized. Add to Cart
    48675 M-ST1n-VP64: Mammalian ST1-VP64 nuclease-null Cas9 activator expression, human optimized. Add to Cart
    48676 M-NMn-VP64: Mammalian NM-VP64 nuclease-null Cas9 activator expression, human optimized. Add to Cart
    48677 M-tdTom-SP: Mammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacer. Add to Cart
    48678 M-tdTom-ST1: Mammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacer. Add to Cart
    48679 M-tdTom-NM: Mammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacer. Add to Cart

Request Plasmids

To order, Login or Register a new account. Add the kit or individual plasmids to your cart, then complete the checkout process online. Click here for additional ordering information.