Human CRISPR Inhibition Pooled Library (Dolcetto)
(Pooled Libraries #1000000114, #92385, #92385-LV, #92386, #92386-LV)
-
Purpose
This human CRISPR inhibition library (Dolcetto) is in backbone pXPR_050. This Dolcetto library inhibits over 18,000 human genes and is used for genome-wide inhibition screening.
Each gene inhibited by this library is targeted by 3–6 gRNAs. These gRNAs are split among the two pools: Set A (Cat# 92385) contains gRNAs 1–3, Set B (Cat# 92386) contains gRNAs 4–6. Each pool has a unique set of gRNAs, but both pools are designed to target the same genes. The slight discrepancy in number of genes targeted between Set A and Set B is because not all genes had six gRNAs.
Depositor comments: Primers for the lentiGuide backbone can be used with this library in the Sequencing Protocol.
-
Vector Backbone
pXPR_050 (Plasmid #96925) - does not express dCas9
-
Depositing Labs
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | ||
|---|---|---|---|---|---|---|
| Pooled Library | 1000000114 | Two tubes, each with a half-library (Set A and B) in backbone XPR_500†
|
1 | $642 | Add to Cart | |
| Pooled Library | 92385 | Set A, one tube, contains Human CRISPRi sgRNA library Dolcetto† | 1 | $386 | Add to Cart | |
| Lentiviral Prep | 92385-LV |
Virus (1.15x108 TU, titer ≥ 5x106 TU/mL)
and Pooled Library DNA More Information |
1 | |||
| Pooled Library | 92386 | Set B, one tube, contains Human CRISPRi sgRNA library Dolcetto† | 1 | $386 | Add to Cart | |
| Lentiviral Prep | 92386-LV |
Virus (1.15x108 TU, titer ≥ 5x106 TU/mL)
and Pooled Library DNA More Information |
1 | |||
Library Details
-
SpeciesHuman
-
Genes targeted18,901 (Set A), 18,899 (Set B)
-
gRNAs57,050 (Set A), 57,011 (Set B)
-
Controls500 unique non-targeting controls are in each of the two half-libraries (Set A and Set B)
-
Lentiviral Generation3rd
Library Shipping
Each library is delivered in a microcentrifuge tube on blue ice. The tube's contents will not necessarily be frozen. For best results, minimize freeze/thaws.
Pooled libraries #92385 and #92386 will be delivered as a single tube containing a pooled half-library with 3 gRNAs per gene.
Pooled library #1000000114 will be delivered as two tubes, each containing a pooled half-library with 3 gRNAs per gene (for a total of up to 6 unique gRNAs per gene).
-
Volume∼20 µL
-
Concentration50 ng/µL
Resource Information
-
Protocols
-
Depositor Data
-
Articles Citing this Pooled Library
-
Terms and Licenses
Academic/Nonprofit TermsIndustry Terms- Not Available to Industry
Trademarks- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/356626 (Link opens in a new window) for bioRxiv preprint.
Information for Lentiviral Prep (Catalog # 92385-LV, Set A) ( Back to top )
Purpose
Ready-to-use lentiviral pooled library for CRISPR inhibition screening in human cells. Contains 57,050 sgRNAs, targeting 18,901 genes. Lentiviral particles carrying set A of the Dolcetto human CRISPR sgRNA inhibition library in backbone pXPR_050.
Delivery
- Volume varies depending on titer
- Titer ≥ 5 x 10⁶ TU/mL
- Storage Store at -80 ℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Pooled Library DNA (10 µL at 50 ng/µL) will also be included in the shipment.
Viral Production & Use
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Viral Quality Control
- ddPCR: 293T cells are transduced with serial dilutions of 92385-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.
-
PCR was carried out with primers targeting the U6 and EF1alpha promoters. The PCR product was visualized on an agarose gel for size confirmation.
- Forward Primer: hU6-F, GAGGGCCTATTTCCCATGATT
- Reverse Primer: EF1a-R, CACGGCGACTACTGCACTTA
Visit our viral production page for more information.
Addgene Comments
Shipment specifications:This pooled library is shipped on dry ice as multiple aliquots, for a total of at least 1.15 x 108 transducing units. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.
How to use this virus:We recommend using one aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in a related publication. Before using this virus, Addgene strongly recommends reading this related publication from the same lab (Doench et al., 2016 (Link opens in a new window)).
A brief and partial description of how to use this virus:
-
Start by optimizing the infection conditions in your cell line in order to achieve 30–50% infection efficiency, corresponding to a multiplicity of infection (MOI) of ~0.5–1. Infect 2.5 x 106 suspension (or 3 x 106 adherent) cells in each well of a 12-well dish at different MOIs. Determine which condition yields a 30–50% infection efficiency, and note the infection efficiency for this condition.
-
The Dolcetto CRISPR inhibition pooled library (set A) has 57,050 gRNAs. To achieve the recommended representation of ~400 cells per sgRNA, a total of ~2.3 x 107 infected cells is needed. Calculate the number of cells on which to perform the infection by considering the infection efficiency noted in the optimized condition. For example, if the infection efficiency is 50%, perform the infection on 4.5 x 107 cells to ultimately achieve 2.3 x 107 infected cells.
-
Perform the screening-scale infection with the pre-determined MOI in the same 12-well format as the optimized condition. Briefly, infect 2.5 x 106 suspension (or 3 x 106 adherent) cells in each well of a 12-well dish. Scale up the number of wells to achieve the desired total number of cells.
-
Based on a screening MOI of 0.5–1 and the total number of cells infected, Addgene estimates that 3–10 mL of virus will be needed to perform the screen. An additional 1 mL of virus will be needed to perform the optimization. Based on the infection efficiency observed in each cell line, these estimates are subject to variation. Not every cell type is infectable under these conditions, and Addgene recommends that infectability of cells be determined empirically.
Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.
-
This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in a related publication (Doench et al., 2016 (Link opens in a new window)), perform screen analysis by determining the log2-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014 (Link opens in a new window)).
-
The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Amplification Protocol for more information.
Information for Lentiviral Prep (Catalog # 92386-LV, Set B) ( Back to top )
Purpose
Ready-to-use lentiviral pooled library for CRISPR inhibition screening in human cells. Contains 57,011 sgRNAs, targeting 18,899 genes. Lentiviral particles carrying set B of the Dolcetto human CRISPR sgRNA inhibition library in backbone pXPR_050.
Delivery
- Volume varies depending on titer
- Titer ≥ 5x10⁶ TU/mL
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Pooled Library DNA (10µL at 50ng/µL) will also be included in the shipment.
Viral Production & Use
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Viral Quality Control
- ddPCR: 293T cells are transduced with serial dilutions of 92386-LV, harvested several days later, and genomic DNA is isolated. Copies of RRE are measured and normalized to RPP30.
- PCR was carried out with primers targeting the U6 and EF1alpha promoters. The PCR product was visualized on an agarose gel for size confirmation.
- Forward Primer: hU6-F, GAGGGCCTATTTCCCATGATT
- Reverse Primer: EF1a-R, CACGGCGACTACTGCACTTA
Visit our viral production page for more information.
Addgene Comments
Shipment specifications:This pooled library is shipped on dry ice as multiple aliquots, for a total of at least 1.15×108 transducing units. Each viral service request also includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.
How to use this virus:We recommend using one aliquot of virus to determine optimal infection conditions before performing screening-scale infections. Detailed methods for determining optimal infection conditions, screening, and validating hits are described in a related publication. Before using this virus, Addgene strongly recommends reading this related publication from the same lab (Doench et al., 2016 (Link opens in a new window)).
A brief and partial description of how to use this virus:
-
Start by optimizing the infection conditions in your cell line in order to achieve 30-50% infection efficiency, corresponding to a multiplicity of infection (MOI) of ~0.5–1. Infect 2.5×106 suspension (or 3×106 adherent) cells in each well of a 12-well dish at different MOIs. Determine which condition yields a 30-50% infection efficiency, and note the infection efficiency for this condition.
-
The Dolcetto CRISPR inhibition pooled library (set B) has 57,011 gRNAs. To achieve the recommended representation of ~400 cells per sgRNA, a total of ~2.3×107 infected cells is needed. Calculate the number of cells on which to perform the infection by considering the infection efficiency noted in the optimized condition. For example, if the infection efficiency is 50%, perform the infection on 4.5×107 cells to ultimately achieve 2.3×107 infected cells.
-
Perform the screening-scale infection with the pre-determined MOI in the same 12-well format as the optimized condition. Briefly, infect 2.5×106 suspension (or 3×106 adherent) cells in each well of a 12-well dish. Scale up the number of wells to achieve the desired total number of cells.
-
Based on a screening MOI of 0.5-1 and the total number of cells infected, Addgene estimates that 3-10 mL of virus will be needed to perform the screen. An additional 1 mL of virus will be needed to perform the optimization. Based on the infection efficiency observed in each cell line, these estimates are subject to variation. Not every cell type is infectable under these conditions, and Addgene recommends that infectability of cells be determined empirically.
Distribution of this pooled lentiviral library includes virus associated DNA, which is a sample of the purified plasmid DNA pool that was used to generate lentivirus.
-
This purified plasmid DNA pool can be sequenced and used as the starting plasmid DNA (pDNA) pool reference when performing screen analysis. As described in a related publication (Doench et al., 2016 (Link opens in a new window)), perform screen analysis by determining the log2-fold-change of each single-guide RNA relative to the pDNA pool. The pDNA has been shown to serve as a good surrogate for an early time point and is more cost effective when performing many screens (Shalem et al., 2014 (Link opens in a new window)).
-
The purified plasmid DNA pool can be amplified to make more pooled plasmid library stock DNA. See our Library Amplification Protocol for more information.
These pooled libraries were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Human Dolcetto CRISPR Inhibition Pooled Library (Set A and B) was a gift from David Root and John Doench (Addgene #1000000114)
Human Dolcetto CRISPR Inhibition Pooled Library Set A was a gift from David Root and John Doench (Addgene #92385 ; http://n2t.net/addgene:92385 ; RRID:Addgene_92385)
Human Dolcetto CRISPR Inhibition Pooled Library Set A was a gift from David Root and John Doench (Addgene #92385-LV ; http://n2t.net/addgene:92385-LV ; RRID:Addgene_92385-LV)
Human Dolcetto CRISPR Inhibition Pooled Library Set B was a gift from David Root and John Doench (Addgene #92386 ; http://n2t.net/addgene:92386 ; RRID:Addgene_92386)
Human Dolcetto CRISPR Inhibition Pooled Library Set B was a gift from David Root and John Doench (Addgene #92386) in the above sentence with: (Addgene viral prep # 92386-LV ; http://n2t.net/addgene:92386-LV ; RRID:Addgene_92386-LV) -
For your References section:
Optimized libraries for CRISPR-Cas9 genetic screens with multiple modalities. Sanson KR, Hanna RE, Hegde M, Donovan KF, Strand C, Sullender ME, Vaimberg EW, Goodale A, Root DE, Piccioni F, Doench JG. Nat Commun. 2018 Dec 21;9(1):5416. doi: 10.1038/s41467-018-07901-8. PubMed 30575746