-
PurposeEnhanced red-shifted bioluminescence when paired with diphenylterazine (DTZ)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100026 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerThermo Fisher
- Backbone size w/o insert (bp) 5446
- Total vector size (bp) 6000
-
Modifications to backbonenone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameteLuc, a NanoLuc mutant
-
SpeciesSynthetic
-
Insert Size (bp)555
-
MutationD19S, D85N, C164H
-
GenBank IDKX963378
- Promoter CMV
-
Tag
/ Fusion Protein
- c-myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ATTTAGGTGACACTATAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see https://med.virginia.edu/ai-lab/samples/ for Practical Notes describing the use of this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-teLuc c-myc was a gift from Huiwang Ai (Addgene plasmid # 100026 ; http://n2t.net/addgene:100026 ; RRID:Addgene_100026) -
For your References section:
Red-shifted luciferase-luciferin pairs for enhanced bioluminescence imaging. Yeh HW, Karmach O, Ji A, Carter D, Martins-Green MM, Ai HW. Nat Methods. 2017 Sep 4. doi: 10.1038/nmeth.4400. 10.1038/nmeth.4400 PubMed 28869756