pGL4-Cluster Promoter Delta 2
(Plasmid
#100127)
-
PurposeIt contains ~4.8 Kb of the miR-183-96-182 cluster promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100127 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL4
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4334
- Total vector size (bp) 9066
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR-183-96-82 Cluster promoter 4.8Kb Fragment
-
Alt namemiR-182 cluster promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4732
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TAGCAAAATAGGCTGTCCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's sequencing results found the following discrepancies compared to the depositor's sequence: 367A>G, 739G>A, 928_929insA, 945delA, 1009C>T, 1682G>A, 2324A>T, 2503G>C, 3233A>G, 4092delG, 4784G>T. These differences could be SNPs and do not occur near the binding sites of the transcription factors of interest; thus they should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4-Cluster Promoter Delta 2 was a gift from Eva Hernando (Addgene plasmid # 100127 ; http://n2t.net/addgene:100127 ; RRID:Addgene_100127) -
For your References section:
Kruppel-like factor 4 (KLF4) regulates the miR-183~96~182 cluster under physiologic and pathologic conditions. Segura MF, Jubierre L, Li S, Soriano A, Koetz L, Gaziel-Sovran A, Masanas M, Kleffman K, Dankert JF, Walsh MJ, Hernando E. Oncotarget. 2017 Apr 18;8(16):26298-26311. doi: 10.18632/oncotarget.15459. 10.18632/oncotarget.15459 PubMed 28412746