Skip to main content
Addgene

pCAGGS-PHFF-sh-hBVRA
(Plasmid #100285)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100285 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Backbone manufacturer
    Junichi Miyazaki (Osaka University, Japan)
  • Backbone size w/o insert (bp) 4870
  • Total vector size (bp) 8551
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    MTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
  • Alt name
    PHFF (synthetic genes)
  • Alt name
    PcyA (Phycocyanobilin:ferredoxin oxidoreductase), HO1 (Heme Oxigenase 1), Fd (Ferredoxin), Fnr (Ferredoxin-NADP+ reductase)
  • Species
    Thermosynechococcus elongatus bp-1 for PcyA and HO1, and Synechocystis sp. PCC 6803 for Fd and Fnr.
  • Insert Size (bp)
    3681
  • Mutation
    All genes are codon-optimized for expression in human cells.
  • Promoter CAG promoter
  • Tags / Fusion Proteins
    • Mitochondria-targeting sequence (MTS), HA, Myc (N terminal on insert)
    • FLAG, T7 (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer catgttcatgccttcttctttttcc
  • 3′ sequencing primer agatgctcaaggggcttcatgatg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    shRNA for human BVRA
  • Alt name
    sh-hBVRA
  • Insert Size (bp)
    67
  • Promoter H1 promoter

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Expression vector for Phycocyanobilin (PCB) synthesis in mammalian cells. In addition, shRNA targeting to human BVRA is expressed so that PCB is further accumulated.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS-PHFF-sh-hBVRA was a gift from Kazuhiro Aoki (Addgene plasmid # 100285 ; http://n2t.net/addgene:100285 ; RRID:Addgene_100285)
  • For your References section:

    Efficient synthesis of phycocyanobilin in mammalian cells for optogenetic control of cell signaling. Uda Y, Goto Y, Oda S, Kohchi T, Matsuda M, Aoki K. Proc Natl Acad Sci U S A. 2017 Oct 24. pii: 201707190. doi: 10.1073/pnas.1707190114. 10.1073/pnas.1707190114 PubMed 29078307