Skip to main content

pLC242-GFP-Sestrin2
(Plasmid #100519)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100519 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIC242
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SESN2
  • Species
    H. sapiens (human)
  • Entrez Gene
    SESN2 (a.k.a. HI95, SES2, SEST2)
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCATGGACGAGCTGTACAAG
  • 3′ sequencing primer GCATTCATTTTATGTTTCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLC242-GFP-Sestrin2 was a gift from David Sabatini (Addgene plasmid # 100519 ; http://n2t.net/addgene:100519 ; RRID:Addgene_100519)
  • For your References section:

    SAMTOR is an S-adenosylmethionine sensor for the mTORC1 pathway. Gu X, Orozco JM, Saxton RA, Condon KJ, Liu GY, Krawczyk PA, Scaria SM, Harper JW, Gygi SP, Sabatini DM. Science. 2017 Nov 10;358(6364):813-818. doi: 10.1126/science.aao3265. 10.1126/science.aao3265 PubMed 29123071