pLC242-GFP-Sestrin2
(Plasmid
#100519)
-
PurposeExpresses GFP tagged Sestrin2 in mammalian cells to make lentivirus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100519 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepIC242
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSESN2
-
SpeciesH. sapiens (human)
-
Entrez GeneSESN2 (a.k.a. HI95, SES2, SEST2)
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCATGGACGAGCTGTACAAG
- 3′ sequencing primer GCATTCATTTTATGTTTCAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLC242-GFP-Sestrin2 was a gift from David Sabatini (Addgene plasmid # 100519 ; http://n2t.net/addgene:100519 ; RRID:Addgene_100519) -
For your References section:
SAMTOR is an S-adenosylmethionine sensor for the mTORC1 pathway. Gu X, Orozco JM, Saxton RA, Condon KJ, Liu GY, Krawczyk PA, Scaria SM, Harper JW, Gygi SP, Sabatini DM. Science. 2017 Nov 10;358(6364):813-818. doi: 10.1126/science.aao3265. 10.1126/science.aao3265 PubMed 29123071