Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

hgRNA-B21_pLKO-Hyg
(Plasmid #100560)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100560 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1 Hygro
  • Total vector size (bp) 7624
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hgRNA-B21
  • gRNA/shRNA sequence
    GTCGGAGGGAGGTGGGTTAG

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hgRNA-B21_pLKO-Hyg was a gift from George Church (Addgene plasmid # 100560 ; http://n2t.net/addgene:100560 ; RRID:Addgene_100560)
  • For your References section:

    Rapidly evolving homing CRISPR barcodes. Kalhor R, Mali P, Church GM. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5. 10.1038/nmeth.4108 PubMed 27918539