hgRNA-E21_pLKO-Hyg
(Plasmid
#100563)
-
PurposehgRNA-E21 in a lentiviral backbone
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100563 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1 Hygro
- Total vector size (bp) 7624
-
Vector typeMammalian Expression, Lentiviral, CRISPR, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehgRNA-E21
-
gRNA/shRNA sequenceGTTCCAGAGATACTGACGTG
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hgRNA-E21_pLKO-Hyg was a gift from George Church (Addgene plasmid # 100563 ; http://n2t.net/addgene:100563 ; RRID:Addgene_100563) -
For your References section:
Rapidly evolving homing CRISPR barcodes. Kalhor R, Mali P, Church GM. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5. 10.1038/nmeth.4108 PubMed 27918539