AAEL007584-Cas9
(Plasmid
#100706)
-
PurposeThe promoter of AAEL007584 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegypti
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100706 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePiggyBac
- Backbone size w/o insert (bp) 5246
- Total vector size (bp) 15794
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameAAEL007584-hspcas9-GFP
-
SpeciesAedes aegypti, Streptococcus pyogenes
-
Insert Size (bp)8773
- Promoter AAEL007584
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCACAATGGTTAATTCGAGCTCGCCCGGGGTCCTAGGTCGACGATGTAGGTCACGGTCTC
- 3′ sequencing primer AAAAGTTGGTGGTGGGGAGGCCACCGAGTATGGGCGCGCCCCGGCCGTTAACTCGAATCG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameOpie2-dsRed
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)926
- Promoter Opie2
-
Tag
/ Fusion Protein
- dsRED (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGATTCGAGTTAACGGCCGGGgcgcgcccatactcggtggcctccccacca
- 3′ sequencing primer AACATTGTCAGATCCGAGATCGGCCGGCCTAGAAGCTTTAAGATACATTGATGAGTTTGGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAEL007584-Cas9 was a gift from Omar Akbari (Addgene plasmid # 100706 ; http://n2t.net/addgene:100706 ; RRID:Addgene_100706) -
For your References section:
Germline Cas9 expression yields highly efficient genome engineering in a major worldwide disease vector, Aedes aegypti. Li M, Bui M, Yang T, Bowman CS, White BJ, Akbari OS. Proc Natl Acad Sci U S A. 2017 Nov 14. pii: 201711538. doi: 10.1073/pnas.1711538114. 10.1073/pnas.1711538114 PubMed 29138316