Skip to main content

pHis-hMTMR1
(Plasmid #100723)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100723 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 7439
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    MTMR1
  • Alt name
    Myotubularin-related protein 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1539
  • Mutation
    Contains amino acids 95-607
  • Entrez Gene
    MTMR1
  • Promoter T7
  • Tag / Fusion Protein
    • His (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG (T7 promoter primer)
  • 3′ sequencing primer CCGCTGAGCAATAACTAGC (T7 terminator primer)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The MTMR1 construct is for structural determination and contains the PH-GRAM and PTPase domains (amino acids 95-607). PTPase activity was confirmed.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHis-hMTMR1 was a gift from Byung Il Lee (Addgene plasmid # 100723 ; http://n2t.net/addgene:100723 ; RRID:Addgene_100723)
  • For your References section:

    Crystal Structure of Human Myotubularin-Related Protein 1 Provides Insight into the Structural Basis of Substrate Specificity. Bong SM, Son KB, Yang SW, Park JW, Cho JW, Kim KT, Kim H, Kim SJ, Kim YJ, Lee BI. PLoS One. 2016 Mar 28;11(3):e0152611. doi: 10.1371/journal.pone.0152611. eCollection 2016. PONE-D-15-41206 [pii] PubMed 27018598