pLKO-sh-Myocardin
(Plasmid
#100769)
-
PurposeLentiviral expression of shRNA targeting MYOCD
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO.1-puro
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLenti-sh-Myocardin
-
gRNA/shRNA sequenceGTTCCGATCAGTCTTACAG
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)58
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pLKO-sh-FW:Cgtgacgtagaaagtaataatttcttgg
- 3′ sequencing primer pLKO-sh-RVS:ttgtatgtctgttgctattatgtc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-sh-Myocardin was a gift from Joseph Gordon (Addgene plasmid # 100769 ; http://n2t.net/addgene:100769 ; RRID:Addgene_100769) -
For your References section:
Myocardin regulates mitochondrial calcium homeostasis and prevents permeability transition. Mughal W, Martens M, Field J, Chapman D, Huang J, Rattan S, Hai Y, Cheung KG, Kereliuk S, West AR, Cole LK, Hatch GM, Diehl-Jones W, Keijzer R, Dolinsky VW, Dixon IM, Parmacek MS, Gordon JW. Cell Death Differ. 2018 Mar 6. pii: 10.1038/s41418-018-0073-z. doi: 10.1038/s41418-018-0073-z. 10.1038/s41418-018-0073-z [pii] PubMed 29511336