Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO-sh-Myocardin
(Plasmid #100769)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100769 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1-puro
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lenti-sh-Myocardin
  • gRNA/shRNA sequence
    GTTCCGATCAGTCTTACAG
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    58
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pLKO-sh-FW:Cgtgacgtagaaagtaataatttcttgg
  • 3′ sequencing primer pLKO-sh-RVS:ttgtatgtctgttgctattatgtc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-sh-Myocardin was a gift from Joseph Gordon (Addgene plasmid # 100769 ; http://n2t.net/addgene:100769 ; RRID:Addgene_100769)
  • For your References section:

    Myocardin regulates mitochondrial calcium homeostasis and prevents permeability transition. Mughal W, Martens M, Field J, Chapman D, Huang J, Rattan S, Hai Y, Cheung KG, Kereliuk S, West AR, Cole LK, Hatch GM, Diehl-Jones W, Keijzer R, Dolinsky VW, Dixon IM, Parmacek MS, Gordon JW. Cell Death Differ. 2018 Mar 6. pii: 10.1038/s41418-018-0073-z. doi: 10.1038/s41418-018-0073-z. 10.1038/s41418-018-0073-z [pii] PubMed 29511336