Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO-sh-Nix
(Plasmid #100770)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 100770 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1-puro
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lenti-sh-Nix
  • gRNA/shRNA sequence
    CAGTTCCTGGGTGGAGCTA
  • Species
    H. sapiens (human), R. norvegicus (rat)
  • Insert Size (bp)
    58
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pLKO-sh-FW:Cgtgacgtagaaagtaataatttcttgg
  • 3′ sequencing primer pLKO-sh-RVS:ttgtatgtctgttgctattatgtc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-sh-Nix was a gift from Joseph Gordon (Addgene plasmid # 100770 ; http://n2t.net/addgene:100770 ; RRID:Addgene_100770)
  • For your References section:

    BNIP3L/Nix-induced mitochondrial fission, mitophagy, and impaired myocyte glucose uptake are abrogated by PRKA/PKA phosphorylation. da Silva Rosa SC, Martens MD, Field JT, Nguyen L, Kereliuk SM, Hai Y, Chapman D, Diehl-Jones W, Aliani M, West AR, Thliveris J, Ghavami S, Rampitsch C, Dolinsky VW, Gordon JW. Autophagy. 2021 Sep;17(9):2257-2272. doi: 10.1080/15548627.2020.1821548. Epub 2020 Oct 12. 10.1080/15548627.2020.1821548 PubMed 33044904