pTRIPZ shCUX1-5328
(Plasmid
#100815)
-
PurposeLentiviral vector expressing a doxycycline-inducible short hairpin RNA against CUX1 sequence starting at 5328 of M74099
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100815 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRIPZ
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTGCTGTTGACAGTGAGCGTCTTCTCGTTTGAAACTTTGAATAGTGAAGCCA
-
gRNA/shRNA sequenceshRNA 5328
-
GenBank IDHs CUX1 M74099
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIPZ shCUX1-5328 was a gift from Alain Nepveu (Addgene plasmid # 100815 ; http://n2t.net/addgene:100815 ; RRID:Addgene_100815) -
For your References section:
RAS transformation requires CUX1-dependent repair of oxidative DNA damage. Ramdzan ZM, Vadnais C, Pal R, Vandal G, Cadieux C, Leduy L, Davoudi S, Hulea L, Yao L, Karnezis AN, Paquet M, Dankort D, Nepveu A. PLoS Biol. 2014 Mar 11;12(3):e1001807. doi: 10.1371/journal.pbio.1001807. eCollection 2014 Mar. PBIOLOGY-D-13-03283 [pii] PubMed 24618719