Skip to main content

pTRIPZ shCUX1-5328
(Plasmid #100815)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100815 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTRIPZ
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TGCTGTTGACAGTGAGCGTCTTCTCGTTTGAAACTTTGAATAGTGAAGCCA
  • gRNA/shRNA sequence
    shRNA 5328
  • GenBank ID
    Hs CUX1 M74099

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIPZ shCUX1-5328 was a gift from Alain Nepveu (Addgene plasmid # 100815 ; http://n2t.net/addgene:100815 ; RRID:Addgene_100815)
  • For your References section:

    RAS transformation requires CUX1-dependent repair of oxidative DNA damage. Ramdzan ZM, Vadnais C, Pal R, Vandal G, Cadieux C, Leduy L, Davoudi S, Hulea L, Yao L, Karnezis AN, Paquet M, Dankort D, Nepveu A. PLoS Biol. 2014 Mar 11;12(3):e1001807. doi: 10.1371/journal.pbio.1001807. eCollection 2014 Mar. PBIOLOGY-D-13-03283 [pii] PubMed 24618719