Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #100890)


Item Catalog # Description Quantity Price (USD)
Plasmid 100890 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 6076
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Protein Kinase CAMP-Activated Catalytic Subunit Alpha
  • Alt name
  • Alt name
    PKA C-Alpha
  • Species
    H. sapiens (human)
  • Mutation
    Isoform 1 wild type
  • GenBank ID
  • Entrez Gene
    PRKACA (a.k.a. PKACA, PPNAD4)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The insert was artificially synthesized

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcrDNA3.1-PRKACA was a gift from Sanford Simon (Addgene plasmid # 100890 ; ; RRID:Addgene_100890)
  • For your References section:

    Detection of a recurrent DNAJB1-PRKACA chimeric transcript in fibrolamellar hepatocellular carcinoma. Honeyman JN, Simon EP, Robine N, Chiaroni-Clarke R, Darcy DG, Lim II, Gleason CE, Murphy JM, Rosenberg BR, Teegan L, Takacs CN, Botero S, Belote R, Germer S, Emde AK, Vacic V, Bhanot U, LaQuaglia MP, Simon SM. Science. 2014 Feb 28;343(6174):1010-4. doi: 10.1126/science.1249484. 10.1126/science.1249484 PubMed 24578576