pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6m-WPRE-pA (PV3413)
(Plasmid
#100906)
-
PurposeAAV bicistronic vector expressing mRuby2 and GCaMP6m from a single open reading frame.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 100906 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemRuby2-P2A-GCaMP6m
-
SpeciesSynthetic
- Promoter hSyn1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer actcagcgctgcctcagtct
- (Common Sequencing Primers)
Resource Information
Depositor Comments
This plasmid is also known as pAAV.hSyn1.mRuby2.GSG.P2A.GCaMP6m.WPRE.SV40 (Addgene51473) p3413 from the Penn Vector Core.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6m-WPRE-pA (PV3413) was a gift from Tobias Bonhoeffer & Mark Huebener & Tobias Rose (Addgene plasmid # 100906) -
For your References section:
Cell-specific restoration of stimulus preference after monocular deprivation in the visual cortex. Rose T, Jaepel J, Hubener M, Bonhoeffer T. Science. 2016 Jun 10;352(6291):1319-22. doi: 10.1126/science.aad3358. 10.1126/science.aad3358 PubMed 27284193