Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #100949)


Item Catalog # Description Quantity Price (USD)
Plasmid 100949 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Koffas Lab - RPI
  • Backbone size w/o insert (bp) 5203
  • Total vector size (bp) 9681
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Alt name
    Tyrosine Ammonia Lyase
  • Alt name
  • Alt name
    Phenylalanine Ammonia Lyase
  • Species
    Rhodotorula glutinis
  • Insert Size (bp)
  • Mutation
    Silent mutation to remove internal NdeI site on TAL
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
    E. coli
  • Insert Size (bp)
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer ATGAAACCAGAAGATTTCCGC
  • 3′ sequencing primer TTATTTCAGCAGCTTATCCAGCATG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
  • Species
    E. coli
  • Insert Size (bp)
  • Promoter T7

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer ATGCAATTAGATGAACAACGC
  • 3′ sequencing primer TTAAATCGCAGCTTCCATTTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETM6-RgTALsyn-HpaBC was a gift from Mattheos Koffas (Addgene plasmid # 100949 ; ; RRID:Addgene_100949)
  • For your References section:

    Complete Biosynthesis of Anthocyanins Using E. coli Polycultures. Jones JA, Vernacchio VR, Collins SM, Shirke AN, Xiu Y, Englaender JA, Cress BF, McCutcheon CC, Linhardt RJ, Gross RA, Koffas MAG. MBio. 2017 Jun 6;8(3). pii: e00621-17. doi: 10.1128/mBio.00621-17. 10.1128/mBio.00621-17 PubMed 28588129