Skip to main content

pCAG-c-Myc NLS-FKBP-Venus N-T2A-mRFP
(Plasmid #100979)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 100979 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG IRES Blasticidin
  • Backbone size w/o insert (bp) 6228
  • Total vector size (bp) 7877
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    c-Myc NLS-FKBP-Venus N-T2A-mRFP
  • Species
    Synthetic
  • Insert Size (bp)
    1649
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer TGGGCAACGTGCTGGTTATTG
  • 3′ sequencing primer ATTCCAAGCGGCTTCGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-c-Myc NLS-FKBP-Venus N-T2A-mRFP was a gift from Heinrich Leonhardt (Addgene plasmid # 100979 ; http://n2t.net/addgene:100979 ; RRID:Addgene_100979)
  • For your References section:

    Nanoparticle Mediated Delivery and Small Molecule Triggered Activation of Proteins in the Nucleus. Chiu HY, Bates JA, Helma J, Engelke H, Harz H, Bein T, Leonhardt H. Nucleus. 2018 Sep 14. doi: 10.1080/19491034.2018.1523665. 10.1080/19491034.2018.1523665 PubMed 30217128