Skip to main content
Addgene
Open Menu

pACP-ADRβ2 Control Plasmid
(Plasmid #101128)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101128 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
Add to Cart
DNA 101128-D50 50 μg of DNA in Tris buffer $495 *
Add to Cart
DNA 101128-D100 100 μg of DNA in Tris buffer $585 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pACP
  • Backbone size w/o insert (bp) 6824
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418) ; Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Beta-2-Adrenergic Receptor
  • Alt name
    ADRBeta2
  • Alt name
    ADRB2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1239
  • Entrez Gene
    ADRB2 (a.k.a. ADRB2R, ADRBR, ARB2, B2AR, BAR, BETA2AR)
  • Promoter CMV
  • Tag / Fusion Protein
    • ACP-tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GACGCAAATGGGCGGTAG (CMV Forward Primer)
  • 3′ sequencing primer AGGGAGTACTCACCCCAACA (ST1 Reverse Primer)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Originally cloned by Covalys. The ACP-tag is an N-vector tag. Additional antibiotic resistance to Kanmycin

For more information on this plasmid, please see https://www.addgene.org/depositor-collections/neb-cell-imaging-tags/

This plasmid is covered by one or more patents, trademarks and/or copyrights owned or controlled by New England Biolabs, Inc (NEB). For more information about commercial rights, please contact NEB's Global Business Development team at [email protected].

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACP-ADRβ2 Control Plasmid was a gift from New England Biolabs & Ana Egana (Addgene plasmid # 101128 ; http://n2t.net/addgene:101128 ; RRID:Addgene_101128)
Related items:
Commonly requested with: