-
Purposeto express MCP-YFP fusion protein
-
Depositing Lab
-
Depositing OrganizationUniversity of Virginia
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101160 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti
- Total vector size (bp) 8000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMCP-YFP
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGAGAATTGGCTAGCatggc
- 3′ sequencing primer AAACCCAGGGCTGCCTTGGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MCP-YFP was a gift from Mazhar Adli (Addgene plasmid # 101160 ; http://n2t.net/addgene:101160 ; RRID:Addgene_101160) -
For your References section:
Live cell imaging of low- and non-repetitive chromosome loci using CRISPR-Cas9. Qin P, Parlak M, Kuscu C, Bandaria J, Mir M, Szlachta K, Singh R, Darzacq X, Yildiz A, Adli M. Nat Commun. 2017 Mar 14;8:14725. doi: 10.1038/ncomms14725. 10.1038/ncomms14725 PubMed 28290446