Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

sg14x(MS2) MUC4.1
(Plasmid #101153)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 101153 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSico
  • Total vector size (bp) 8370
  • Modifications to backbone
    none
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin ; BFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MUC4
  • gRNA/shRNA sequence
    GTAAAGTAGAAAAGGCATAAA
  • Species
    H. sapiens (human)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sg14x(MS2) MUC4.1 was a gift from Mazhar Adli (Addgene plasmid # 101153 ; http://n2t.net/addgene:101153 ; RRID:Addgene_101153)
  • For your References section:

    Live cell imaging of low- and non-repetitive chromosome loci using CRISPR-Cas9. Qin P, Parlak M, Kuscu C, Bandaria J, Mir M, Szlachta K, Singh R, Darzacq X, Yildiz A, Adli M. Nat Commun. 2017 Mar 14;8:14725. doi: 10.1038/ncomms14725. 10.1038/ncomms14725 PubMed 28290446