sg2.02 MUC4.1
(Plasmid
#101152)
-
PurposegRNA with two MCP binding sites
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101152 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSico
- Total vector size (bp) 8370
-
Modifications to backbonenone
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin ; BFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMUC4
-
gRNA/shRNA sequenceGTAAAGTAGAAAAGGCATAAA
-
SpeciesH. sapiens (human)
- Promoter mU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstXI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer gacgcgccatctctaggcc
- 3′ sequencing primer atgcatggcggtaatacggttatc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sg2.02 MUC4.1 was a gift from Mazhar Adli (Addgene plasmid # 101152 ; http://n2t.net/addgene:101152 ; RRID:Addgene_101152) -
For your References section:
Live cell imaging of low- and non-repetitive chromosome loci using CRISPR-Cas9. Qin P, Parlak M, Kuscu C, Bandaria J, Mir M, Szlachta K, Singh R, Darzacq X, Yildiz A, Adli M. Nat Commun. 2017 Mar 14;8:14725. doi: 10.1038/ncomms14725. 10.1038/ncomms14725 PubMed 28290446