pRSETb-ffDronpa-F
(Plasmid
#101193)
-
PurposeA fast switching Dronpa variant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101193 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRSETb
- Backbone size w/o insert (bp) 2860
- Total vector size (bp) 3535
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameffDronpa-F
-
Alt nameDronpa K45I V60A F173V
-
Insert Size (bp)675
-
MutationK45I, V60A, F173V
- Promoter T7
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on backbone)
- T7 tag (N terminal on backbone)
- Xpress tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGTTATTGCTCAGCGGTGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSETb-ffDronpa-F was a gift from Peter Dedecker (Addgene plasmid # 101193 ; http://n2t.net/addgene:101193 ; RRID:Addgene_101193) -
For your References section:
Live-cell monochromatic dual-label sub-diffraction microscopy by mt-pcSOFI. Duwe S, Vandenberg W, Dedecker P. Chem Commun (Camb). 2017 Jun 29;53(53):7242-7245. doi: 10.1039/c7cc02344h. 10.1039/c7cc02344h PubMed 28561832