pCZGY2254
(Plasmid
#101247)
-
PurposeGFP subunits 1-10, (only shows active fluorescence when binds to GFP11)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR8 Gateway Entry Vector
- Backbone size w/o insert (bp) 2855
- Total vector size (bp) 3523
-
Vector typeGateway
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegfp1-10
-
SpeciesSynthetic
-
Insert Size (bp)668
-
Tag
/ Fusion Protein
- GFP1-10
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer CAGGAAACAGCTATGACCATG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
When using this clone for publication, please reference:
Noma K, Goncharov A, Ellisman MH, Jin Y. Microtubule-dependent ribosome localization in C. elegans neurons. Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCZGY2254 was a gift from Yishi Jin (Addgene plasmid # 101247 ; http://n2t.net/addgene:101247 ; RRID:Addgene_101247) -
For your References section:
Microtubule-dependent ribosome localization in C. elegans neurons. Noma K, Goncharov A, Ellisman MH, Jin Y. Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376. 10.7554/eLife.26376 PubMed 28767038