Skip to main content

pAAV hSyn1 CaRhGC wt T2A tDimer
(Plasmid #101720)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101720 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 4568
  • Total vector size (bp) 7970
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    CatRhGC
  • Alt name
    CaCyclOP
  • Species
    Cateneraria anguillulae
  • Insert Size (bp)
    1867
  • Promoter hSyn1

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer gactcagcgctgcctcagtctg
  • 3′ sequencing primer GGATTCTCCTCCACGTCACCGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
    tDimer2
  • Species
    Discoma sp.
  • Insert Size (bp)
    1395
  • Promoter ribosomal skip sequence T2A

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ggcagaggaagtcttctaacat
  • 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    CatRhGC originally from P.Hegemann ,HU-Berlin Germany tDimer originally from R.Tsien, USD USA

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV hSyn1 CaRhGC wt T2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 101720 ; http://n2t.net/addgene:101720 ; RRID:Addgene_101720)
  • For your References section:

    Rhodopsin-cyclases for photocontrol of cGMP/cAMP and 2.3 A structure of the adenylyl cyclase domain. Scheib U, Broser M, Constantin OM, Yang S, Gao S, Mukherjee S, Stehfest K, Nagel G, Gee CE, Hegemann P. Nat Commun. 2018 May 24;9(1):2046. doi: 10.1038/s41467-018-04428-w. 10.1038/s41467-018-04428-w PubMed 29799525