Skip to main content

pWUR790
(Plasmid #101723)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 101723 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDF-1b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 3621
  • Total vector size (bp) 5807
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    precultures grown in presence of 0.4% (w/v) glucose
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PfAgo
  • Species
    Pyrococcus furiosus
  • Insert Size (bp)
    2313
  • Promoter T7 Promotor
  • Tag / Fusion Protein
    • Strep(II)-tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site AvrII (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWUR790 was a gift from John van der Oost (Addgene plasmid # 101723 ; http://n2t.net/addgene:101723 ; RRID:Addgene_101723)
  • For your References section:

    Argonaute of the archaeon Pyrococcus furiosus is a DNA-guided nuclease that targets cognate DNA. Swarts DC, Hegge JW, Hinojo I, Shiimori M, Ellis MA, Dumrongkulraksa J, Terns RM, Terns MP, van der Oost J. Nucleic Acids Res. 2015 May 26;43(10):5120-9. doi: 10.1093/nar/gkv415. Epub 2015 Apr 29. 10.1093/nar/gkv415 PubMed 25925567