Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pJH-MBP-CbAgo
(Plasmid #127707)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 127707 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET (Plasmid #29656)
  • Backbone manufacturer
    Scott Gradia
  • Backbone size w/o insert (bp) 6472
  • Total vector size (bp) 8716
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CbAgo
  • Species
    Clostridium butyricum
  • Insert Size (bp)
    2244
  • Promoter T7
  • Tag / Fusion Protein
    • MPB (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJH-MBP-CbAgo was a gift from John van der Oost (Addgene plasmid # 127707 ; http://n2t.net/addgene:127707 ; RRID:Addgene_127707)
  • For your References section:

    DNA-guided DNA cleavage at moderate temperatures by Clostridium butyricum Argonaute. Hegge JW, Swarts DC, Chandradoss SD, Cui TJ, Kneppers J, Jinek M, Joo C, van der Oost J. Nucleic Acids Res. 2019 May 9. pii: 5487266. doi: 10.1093/nar/gkz306. 10.1093/nar/gkz306 PubMed 31069393