pWUR790
(Plasmid #101723)

• Purpose: Synthetic codon optimized P. furiosus ago with N-terminal Strep(II)-tag in pCDF-1b vector, expression vector for PfAgo
• Depositing Lab: John van der Oost
• Publication: Swarts et al Nucleic Acids Res. 2015 May 26;43(10):5120-9. doi: 10.1093/nar/gkv415. Epub 2015 Apr 29.

Backbone

• Vector backbone: pCDF-1b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 3621
• Total vector size (bp): 5807
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Streptomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: precultures grown in presence of 0.4% (w/v) glucose
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PfAgo
• Species: Pyrococcus furiosus
• Insert Size (bp): 2313
• Promoter: T7 Promotor
• Tag / Fusion Protein:
  • Strep(II)-tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (unknown if destroyed)
• 3′ cloning site: AvrII (unknown if destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry