pET28a-FgßF3-ddFLN4-HIS-ybbr
(Plasmid
#101743)
-
Purposemutant FgßF3 peptide (additional phenylalanine) with ddFLN4 fingerprint domain with C-terminal ybbr tag for covalent immobilization - resulting in high forces
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101743 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5216
- Total vector size (bp) 5684
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFgßF3 peptide, ddFLN4 fingerprint
-
SpeciesH. sapiens (human); Dictyostelium discoideum
-
Insert Size (bp)468
-
MutationC18S in ddFLN4, added 9F in FgßF3
-
Entrez GeneFGB (a.k.a. HEL-S-78p)
- Promoter T7
-
Tags
/ Fusion Proteins
- HIS (C terminal on insert)
- ybbr (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CTAGTTATTGCTCAGCGGT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-FgßF3-ddFLN4-HIS-ybbr was a gift from Hermann Gaub (Addgene plasmid # 101743 ; http://n2t.net/addgene:101743 ; RRID:Addgene_101743) -
For your References section:
Molecular mechanism of extreme mechanostability in a pathogen adhesin. Milles LF, Schulten K, Gaub HE, Bernardi RC. Science. 2018 Mar 30;359(6383):1527-1533. doi: 10.1126/science.aar2094. 10.1126/science.aar2094 PubMed 29599244