H14-MBP-SUMO-Cys-Linker-BAF_G47E
(Plasmid
#101779)
-
PurposeExpresses His-MBP-tagged mutant BAF (G47E) in E.coli (SUMO-cleavable)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101779 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonecustom bacterial expression vector
- Backbone size w/o insert (bp) 5517
- Total vector size (bp) 5784
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBAF (BANF1)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)267
-
MutationG47E mutation
-
Entrez GeneBANF1 (a.k.a. BAF, BCRP1, D14S1460, NGPS)
- Promoter T5
-
Tag
/ Fusion Protein
- His14-MBP-SUMO (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
- 3′ sequencing primer GTTCTGAGGTCATTACTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
H14-MBP-SUMO-Cys-Linker-BAF_G47E was a gift from Daniel Gerlich (Addgene plasmid # 101779 ; http://n2t.net/addgene:101779 ; RRID:Addgene_101779) -
For your References section:
DNA Cross-Bridging Shapes a Single Nucleus from a Set of Mitotic Chromosomes. Samwer M, Schneider MWG, Hoefler R, Schmalhorst PS, Jude JG, Zuber J, Gerlich DW. Cell. 2017 Aug 24;170(5):956-972.e23. doi: 10.1016/j.cell.2017.07.038. 10.1016/j.cell.2017.07.038 PubMed 28841419