Adeno BN
(Plasmid
#101823)
-
PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101823 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepacAd5
-
Backbone manufacturerGene Transfer Vector Core University of Iowa
- Backbone size w/o insert (bp) 5678
- Total vector size (bp) 11538
-
Vector typeAdenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameU6_sgRNA(Bcan)_U6_sgRNA(Ntrk1)_CBh_FLAG-Cas9
-
Alt namepacAd5_BN
-
gRNA/shRNA sequenceBcan (intron 13) Ntrk1 (intron 10)
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_001109758.1 NM_001033124.1
-
Entrez GeneBcan (a.k.a. Cspg7)
-
Entrez GeneNtrk1 (a.k.a. Tkr, TrkA, trk)
-
Tag
/ Fusion Protein
- FLAG-Cas9
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer GATGTTGTAGTAAATTTGGG
- 3′ sequencing primer ATCATGTCTGGATCTCCCC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Adeno BN was a gift from Andrea Ventura (Addgene plasmid # 101823 ; http://n2t.net/addgene:101823 ; RRID:Addgene_101823) -
For your References section:
Somatic chromosomal engineering identifies BCAN-NTRK1 as a potent glioma driver and therapeutic target. Cook PJ, Thomas R, Kannan R, de Leon ES, Drilon A, Rosenblum MK, Scaltriti M, Benezra R, Ventura A. Nat Commun. 2017 Jul 11;8:15987. doi: 10.1038/ncomms15987. 10.1038/ncomms15987 PubMed 28695888