Adeno FT
(Plasmid
#101824)
-
PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 101824 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepacAd5
-
Backbone manufacturerGene Transfer Vector Core University of Iowa
- Backbone size w/o insert (bp) 5679
- Total vector size (bp) 11538
-
Vector typeAdenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameU6_sgRNA(Fgfr3)_U6_sgRNA(Tacc3)_CBh_FLAG-Cas9
-
Alt namepacAd5_FT
-
gRNA/shRNA sequenceFgfr3 (intron 17) Tacc3 (intron 6)
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_001163215.2 NM_001040435
-
Entrez GeneFgfr3 (a.k.a. CD333, FR3, Fgfr-, Fgfr-3, Flg-2, HBGF, HBGFR, Mfr3, sa, sam3)
-
Entrez GeneTacc3 (a.k.a. A, Aint, C86661, Eric1)
- Promoter U6 and CBh
-
Tag
/ Fusion Protein
- FLAG-Cas9
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer GATGTTGTAGTAAATTTGGG
- 3′ sequencing primer ATCATGTCTGGATCTCCCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Adeno FT was a gift from Andrea Ventura (Addgene plasmid # 101824 ; http://n2t.net/addgene:101824 ; RRID:Addgene_101824) -
For your References section:
Somatic chromosomal engineering identifies BCAN-NTRK1 as a potent glioma driver and therapeutic target. Cook PJ, Thomas R, Kannan R, de Leon ES, Drilon A, Rosenblum MK, Scaltriti M, Benezra R, Ventura A. Nat Commun. 2017 Jul 11;8:15987. doi: 10.1038/ncomms15987. 10.1038/ncomms15987 PubMed 28695888