pLentiCRISPR sgAMDHD1
(Plasmid
#102316)
-
Purposegenetic depletion of AMDHD1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102316 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLentiCRISPR
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesgAMDHD1
-
gRNA/shRNA sequenceATGGAAATTCACCAGGCCGG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)30
-
Entrez GeneAMDHD1 (a.k.a. HMFT1272, MGC35366)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmB1 (unknown if destroyed)
- 3′ cloning site BsmB1 (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPR sgAMDHD1 was a gift from David Sabatini (Addgene plasmid # 102316 ; http://n2t.net/addgene:102316 ; RRID:Addgene_102316) -
For your References section:
Histidine catabolism is a major determinant of methotrexate sensitivity. Kanarek N, Keys HR, Cantor JR, Lewis CA, Chan SH, Kunchok T, Abu-Remaileh M, Freinkman E, Schweitzer LD, Sabatini DM. Nature. 2018 Jul 11. pii: 10.1038/s41586-018-0316-7. doi: 10.1038/s41586-018-0316-7. 10.1038/s41586-018-0316-7 PubMed 29995852