pCDH-SIRT6-H133Y
(Plasmid
#102327)
-
PurposeHuman SIRT6 H133Y for mammalian expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102327 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH
- Backbone size w/o insert (bp) 7384
- Total vector size (bp) 8452
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSIRT6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1068
-
Mutationchanged histidine 133 to tyrosine
-
GenBank IDCR457200
-
Entrez GeneSIRT6 (a.k.a. SIR2L6, hSIRT6)
- Promoter CMV
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMV
- 3′ sequencing primer CTCTAGGCACCCGTTCAATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-SIRT6-H133Y was a gift from Hening Lin (Addgene plasmid # 102327 ; http://n2t.net/addgene:102327 ; RRID:Addgene_102327) -
For your References section:
Identifying the functional contribution of the defatty-acylase activity of SIRT6. Zhang X, Khan S, Jiang H, Antonyak MA, Chen X, Spiegelman NA, Shrimp JH, Cerione RA, Lin H. Nat Chem Biol. 2016 Aug;12(8):614-20. doi: 10.1038/nchembio.2106. Epub 2016 Jun 20. 10.1038/nchembio.2106 PubMed 27322069