pHR SFFVp BFP-Erk D319N
(Plasmid
#102350)
-
PurposeLentiviral expressing translational fusion between blue fluorescent protein and Erk2 bearing the D319N mutation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102350 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameErk2
-
Alt nameMAPK1
-
SpeciesM. musculus (mouse)
-
MutationAspartic acid 319 was mutated to asparagine
-
Entrez GeneMapk1 (a.k.a. 9030612K14Rik, ERK, Erk2, MAPK2, PRKM2, Prkm1, p41mapk, p42mapk)
- Promoter SFFV
-
Tag
/ Fusion Protein
- BFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcttcccgagctctataaaagagc
- 3′ sequencing primer ttgatatcaagcttgcatgcctgc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR SFFVp BFP-Erk D319N was a gift from Jared Toettcher (Addgene plasmid # 102350 ; http://n2t.net/addgene:102350 ; RRID:Addgene_102350) -
For your References section:
Tracing Information Flow from Erk to Target Gene Induction Reveals Mechanisms of Dynamic and Combinatorial Control. Wilson MZ, Ravindran PT, Lim WA, Toettcher JE. Mol Cell. 2017 Sep 7;67(5):757-769.e5. doi: 10.1016/j.molcel.2017.07.016. Epub 2017 Aug 17. 10.1016/j.molcel.2017.07.016 PubMed 28826673