mAzami-Green-Galectin
(Plasmid
#102419)
-
PurposeExpresses mAzami-labeled galectin 3 (Gal3) as a marker for endosomal leakage or rupture.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102419 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA6-myc his version B
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLGALS3
-
Alt nameGalectin-3
-
Alt name35 kDa lectin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)765
-
GenBank IDNM_002306.3
-
Entrez GeneLGALS3 (a.k.a. CBP35, GAL3, GALBP, GALIG, L31, LGALS2, MAC2)
- Promoter CMV
-
Tag
/ Fusion Protein
- mAzami-green (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site PspOMI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe insert is from plasmid mAG-GAL3 (Addgene plasmid #62734), from the lab of Niels Geijsen and has been described in [D’Astolfo, D. S. et al. Efficient intracellular delivery of native proteins. Cell 161, 674–690 (2015)].
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The his-tag and myc-tag are NOT in frame with the Gal3-mAzami green.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mAzami-Green-Galectin was a gift from Geert van den Bogaart (Addgene plasmid # 102419 ; http://n2t.net/addgene:102419 ; RRID:Addgene_102419) -
For your References section:
Lipid peroxidation causes endosomal antigen release for cross-presentation. Dingjan I, Verboogen DR, Paardekooper LM, Revelo NH, Sittig SP, Visser LJ, Mollard GF, Henriet SS, Figdor CG, Ter Beest M, van den Bogaart G. Sci Rep. 2016 Feb 24;6:22064. doi: 10.1038/srep22064. 10.1038/srep22064 PubMed 26907999