pSG22-pBAD-TetR
(Plasmid
#102451)
-
PurposeExpresses TetR protein in E. coli. The expression is controlled by a pBAD promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102451 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSC101
- Backbone size w/o insert (bp) 3845
- Total vector size (bp) 4466
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTetR
-
Insert Size (bp)621
-
Entrez GenetetR (a.k.a. D616_p98057)
- Promoter pBAD
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAATGTGCATTGCTGTTCC
- 3′ sequencing primer AAGACAACATACGACTCTCAAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2017/04/02/123190 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG22-pBAD-TetR was a gift from Richard Murray (Addgene plasmid # 102451 ; http://n2t.net/addgene:102451 ; RRID:Addgene_102451) -
For your References section:
Construction of Incoherent Feedforward Loop Circuits in a Cell-Free System and in Cells. Guo S, Murray RM. ACS Synth Biol. 2019 Mar 15;8(3):606-610. doi: 10.1021/acssynbio.8b00493. Epub 2019 Mar 6. 10.1021/acssynbio.8b00493 PubMed 30790525