pSG66-KcsA-Kv1.3-sfGFP
(Plasmid
#102457)
-
PurposeExpresses a fusion protein of KcsA-Kv1.3 and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBEST
- Backbone size w/o insert (bp) 2546
- Total vector size (bp) 3809
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)KL740
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKcsA-Kv1.3
-
Alt nameKcsA
-
Alt nameKv1.3
-
SpeciesChimera
-
Insert Size (bp)495
- Promoter OR2-OR1-Pr
-
Tags
/ Fusion Proteins
- sfGFP (C terminal on insert)
- His tag (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAAACCGAATTTTGCTGGGTG
- 3′ sequencing primer ATGATAAAGAACACAGTCATAAGTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2017/01/30/104455 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG66-KcsA-Kv1.3-sfGFP was a gift from Richard Murray (Addgene plasmid # 102457 ; http://n2t.net/addgene:102457 ; RRID:Addgene_102457) -
For your References section:
Expressing Biologically Active Membrane Proteins in a Cell-Free Transcription-Translation Platform. Guo S, Vaish A, Chen Q, Murray RM. bioRxiv 104455 10.1101/104455