Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET28a-6XHis-SUMO-SIRT2
(Plasmid #102622)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102622 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET28a-6XHis-SUMO
  • Backbone size w/o insert (bp) 5633
  • Total vector size (bp) 6571
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SIRT2
  • Alt name
    Sirtuin 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    984
  • Mutation
    Deleted amino acids 1-37 and 357-389
  • GenBank ID
    NC_000019.10
  • Entrez Gene
    SIRT2 (a.k.a. SIR2, SIR2L, SIR2L2)
  • Tag / Fusion Protein
    • 6XHis-SUMO (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer T7 promoter, TAATACGACTCACTATAGGG
  • 3′ sequencing primer T7 terminator, GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-6XHis-SUMO-SIRT2 was a gift from Hening Lin (Addgene plasmid # 102622 ; http://n2t.net/addgene:102622 ; RRID:Addgene_102622)
  • For your References section:

    A SIRT2-Selective Inhibitor Promotes c-Myc Oncoprotein Degradation and Exhibits Broad Anticancer Activity. Jing H, Hu J, He B, Negron Abril YL, Stupinski J, Weiser K, Carbonaro M, Chiang YL, Southard T, Giannakakou P, Weiss RS, Lin H. Cancer Cell. 2016 Mar 14;29(3):297-310. doi: 10.1016/j.ccell.2016.02.007. 10.1016/j.ccell.2016.02.007 PubMed 26977881