-
PurposeExpresses a truncation (aa38-356) of human SIRT2 isoform 1 in bacteria for purification
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102622 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28a-6XHis-SUMO
- Backbone size w/o insert (bp) 5633
- Total vector size (bp) 6571
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSIRT2
-
Alt nameSirtuin 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)984
-
MutationDeleted amino acids 1-37 and 357-389
-
GenBank IDNC_000019.10
-
Entrez GeneSIRT2 (a.k.a. SIR2, SIR2L, SIR2L2)
-
Tag
/ Fusion Protein
- 6XHis-SUMO (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer T7 promoter, TAATACGACTCACTATAGGG
- 3′ sequencing primer T7 terminator, GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-6XHis-SUMO-SIRT2 was a gift from Hening Lin (Addgene plasmid # 102622 ; http://n2t.net/addgene:102622 ; RRID:Addgene_102622) -
For your References section:
A SIRT2-Selective Inhibitor Promotes c-Myc Oncoprotein Degradation and Exhibits Broad Anticancer Activity. Jing H, Hu J, He B, Negron Abril YL, Stupinski J, Weiser K, Carbonaro M, Chiang YL, Southard T, Giannakakou P, Weiss RS, Lin H. Cancer Cell. 2016 Mar 14;29(3):297-310. doi: 10.1016/j.ccell.2016.02.007. 10.1016/j.ccell.2016.02.007 PubMed 26977881