Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJL1-dTomato
(Plasmid #102631)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 102631 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJL1
  • Backbone size w/o insert (bp) 1759
  • Total vector size (bp) 2476
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    tdTomato
  • Insert Size (bp)
    713
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGTTATTGCTCAGCGGTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    tdTomato insert is from Addgene #54856

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJL1-dTomato was a gift from Michael Jewett (Addgene plasmid # 102631 ; http://n2t.net/addgene:102631 ; RRID:Addgene_102631)
  • For your References section:

    BioBits Bright: A fluorescent synthetic biology education kit. Stark JC, Huang A, Nguyen PQ, Dubner RS, Hsu KJ, Ferrante TC, Anderson M, Kanapskyte A, Mucha Q, Packett JS, Patel P, Patel R, Qaq D, Zondor T, Burke J, Martinez T, Miller-Berry A, Puppala A, Reichert K, Schmid M, Brand L, Hill LR, Chellaswamy JF, Faheem N, Fetherling S, Gong E, Gonzalzles EM, Granito T, Koritsaris J, Nguyen B, Ottman S, Palffy C, Patel A, Skweres S, Slaton A, Woods T, Donghia N, Pardee K, Collins JJ, Jewett MC. Sci Adv. 2018 Aug 1;4(8):eaat5107. doi: 10.1126/sciadv.aat5107. eCollection 2018 Aug. 10.1126/sciadv.aat5107 PubMed 30083609