pUC19, containing H2-Kb c57/BL6 WK9
(Plasmid
#102641)
-
PurposeEncodes sequence of the murine H2-Kb allele
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102641 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepuc19
- Backbone size w/o insert (bp) 2300
- Total vector size (bp) 6600
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameH2-Kd Balb/c
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4300
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAACCAATCAGTGTCGCCGCG
- 3′ sequencing primer TAGTGACCCAGATTCTGGAAGTTTATTCATCTATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19, containing H2-Kb c57/BL6 WK9 was a gift from Sai Reddy (Addgene plasmid # 102641 ; http://n2t.net/addgene:102641 ; RRID:Addgene_102641) -
For your References section:
Reprogramming MHC specificity by CRISPR-Cas9-assisted cassette exchange. Kelton W, Waindok AC, Pesch T, Pogson M, Ford K, Parola C, Reddy ST. Sci Rep. 2017 Apr 4;7:45775. doi: 10.1038/srep45775. 10.1038/srep45775 PubMed 28374766