Skip to main content
Addgene

pAAV-CamKIIa-ChrimsonR::FusionRed::Kv2.1
(Plasmid #102770)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102770 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5366
  • Total vector size (bp) 7352
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ChrimsonR::FusionRed::Kv2.1
  • Insert Size (bp)
    1986
  • Tags / Fusion Proteins
    • FusionRed (C terminal on insert)
    • Kv2.1 traficking domain (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTCACCAGCTACAGTCTACCTTTC
  • 3′ sequencing primer CACGTTGTAAACGCCTGGTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CamKIIa-ChrimsonR::FusionRed::Kv2.1 was a gift from Karel Svoboda (Addgene plasmid # 102770 ; http://n2t.net/addgene:102770 ; RRID:Addgene_102770)
  • For your References section:

    Targeted photostimulation uncovers circuit motifs supporting short-term memory. Daie K, Svoboda K, Druckmann S. Nat Neurosci. 2021 Feb;24(2):259-265. doi: 10.1038/s41593-020-00776-3. Epub 2021 Jan 25. 10.1038/s41593-020-00776-3 PubMed 33495637