Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #102784)


Item Catalog # Description Quantity Price (USD)
Plasmid 102784 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4722
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Mutation
    changed asparagine 308 to aspartate; *(see below)
  • GenBank ID
  • Entrez Gene
    APPL1 (a.k.a. APPL, DIP13alpha, MODY14)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

*Note: Addgene's quality control sequencing finds additional residues KPNSAVDGTAGPGSTGSR appended to the C-terminus of the APPL1 protein. These additional residues are not thought to affect protein function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    APPL1-N308D-mCherry was a gift from Donna Webb (Addgene plasmid # 102784 ; ; RRID:Addgene_102784)