pBW_0059
(Plasmid
#102819)
-
PurposepAGM4723 containing Sr35 gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102819 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAGM4723
-
Vector typeSynthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namewheat stem rust resistance gene Sr35
-
SpeciesSynthetic
-
Insert Size (bp)8247
-
Entrez GeneNEWENTRY
- Promoter Native
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer GTGGTGTAAACAAATTGACGC
- 3′ sequencing primer GGATAAACCTTTTCACGCCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the Addgene NGS results identified point mutations compared to the NCBI reference sequences, but these mutations do not affect plasmid function as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBW_0059 was a gift from Brande Wulff (Addgene plasmid # 102819 ; http://n2t.net/addgene:102819 ; RRID:Addgene_102819) -
For your References section:
Extensive Genetic Variation at the Sr22 Wheat Stem Rust Resistance Gene Locus in the Grasses Revealed Through Evolutionary Genomics and Functional Analyses. Md Hatta MA, Ghosh S, Athiyannan N, Richardson T, Steuernagel B, Yu G, Rouse MN, Ayliffe M, Lagudah ES, Radhakrishnan GV, Periyannan SK, Wulff BBH. Mol Plant Microbe Interact. 2020 Nov;33(11):1286-1298. doi: 10.1094/MPMI-01-20-0018-R. Epub 2020 Oct 1. 10.1094/MPMI-01-20-0018-R PubMed 32779520